Stem-loop sequence mdo-mir-7272

AccessionMI0023775 (change log)
DescriptionMonodelphis domestica miR-7272 stem-loop
Stem-loop
   --   a         u       aga  a  c 
5'   ggg caguucugg uuuguca   gu uu u
     ||| ||||||||| |||||||   || ||  
3'   ccc gucaagauc aaacagu   cg aa g
   ua   c         c       ---  g  g 
Get sequence
Deep sequencing
102 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 173163237-173163297 [+]
sense
ENSMODT00000018614 ; TRIM37-201; intron 8
Database links

Mature sequence mdo-miR-7272-5p

Accession MIMAT0028516
Sequence

1 - 

gggacaguucugguuuuguca

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7272-3p

Accession MIMAT0028517
Sequence

41 - 

acaaaccuagaacugccccau

 - 61

Get sequence
Deep sequencing95 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).