Stem-loop sequence mdo-mir-130c-1

AccessionMI0023774 (change log)
DescriptionMonodelphis domestica miR-130c-1 stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   --        u          a  ---a   au 
5'   gcccuuuu auguuguacu cu    gug  c
     |||||||| |||||||||| ||    |||   
3'   cgggaaaa uguaacguga ga    cac  c
   ua        u          c  agaa   gu 
Get sequence
Deep sequencing
12553 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 172985794-172985856 [+]
sense
ENSMODT00000043062 ; SKA2-201; intron 1
ENSMODT00000040265 ; mdo-mir-130c-1-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-130c-1
mdo-mir-130c-1chr2: 172985794-172985856 [+]
mdo-mir-301chr2: 172986774-172986858 [+]
Database links

Mature sequence mdo-miR-130c-1-5p

Accession MIMAT0028514
Sequence

1 - 

gcccuuuuuauguuguacuacu

 - 22

Get sequence
Deep sequencing12 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-130c-3p

Accession MIMAT0028515
Sequence

42 - 

cagugcaauguuaaaagggcau

 - 63

Get sequence
Deep sequencing25036 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).