Stem-loop sequence mdo-mir-7271

AccessionMI0023773 (change log)
DescriptionMonodelphis domestica miR-7271 stem-loop
Stem-loop
   --  u       u  cg  u        
5'   uc uagcacu cc  cu cgccauc 
     || ||||||| ||  || |||||| a
3'   ag auuguga gg  gg gcgguag 
   uu  u       u  aa  u        
Get sequence
Deep sequencing
2729 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 9613529-9613581 [+]
intergenic
Database links

Mature sequence mdo-miR-7271-5p

Accession MIMAT0028512
Sequence

1 - 

ucuuagcacuucccgcuucgcc

 - 22

Get sequence
Deep sequencing2184 reads, 4 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7271-3p

Accession MIMAT0028513
Sequence

32 - 

cguggaagguaguguuaugauu

 - 53

Get sequence
Deep sequencing542 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).