Stem-loop sequence mdo-mir-7270

AccessionMI0023772 (change log)
DescriptionMonodelphis domestica miR-7270 stem-loop
Stem-loop
   --          -g  -    aa     uga 
5'   uaagaucaca  ag ucug  gaguc   a
     ||||||||||  || ||||  |||||    
3'   guucuagugu  uc ggac  cucag   a
   gu          gg  u    --     ucc 
Get sequence
Deep sequencing
74444 reads, 960 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 541551023-541551080 [-]
sense
ENSMODT00000003505 ; IGF2BP2-201; intron 7
Clustered miRNAs
< 10kb from mdo-mir-7270
mdo-mir-7270chr2: 541551023-541551080 [-]
mdo-mir-7269chr2: 541547457-541547520 [-]
mdo-mir-1548chr2: 541547258-541547317 [-]
Database links

Mature sequence mdo-miR-7270-5p

Accession MIMAT0028510
Sequence

1 - 

uaagaucacagagucugaagagu

 - 23

Get sequence
Deep sequencing71784 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7270-3p

Accession MIMAT0028511
Sequence

36 - 

uccaggucuggugugaucuugug

 - 58

Get sequence
Deep sequencing2657 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).