Stem-loop sequence mdo-mir-7269

AccessionMI0023771 (change log)
DescriptionMonodelphis domestica miR-7269 stem-loop
Stem-loop
   a    --u    ca   c u   c  ugg uua 
5'  gaaa   cugu  ggg g ggg gc   c   u
    ||||   ||||  ||| | ||| ||   |    
3'  cuuu   gacg  ccc c ccc cg   g   c
   c    uuu    aa   - c   a  -ua uaa 
Get sequence
Deep sequencing
105872 reads, 1.56e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 541547457-541547520 [-]
sense
ENSMODT00000003505 ; IGF2BP2-201; intron 7
Clustered miRNAs
< 10kb from mdo-mir-7269
mdo-mir-7270chr2: 541551023-541551080 [-]
mdo-mir-7269chr2: 541547457-541547520 [-]
mdo-mir-1548chr2: 541547258-541547317 [-]
Database links

Mature sequence mdo-miR-7269-5p

Accession MIMAT0028508
Sequence

1 - 

agaaaucugucagggcgugggcg

 - 23

Get sequence
Deep sequencing104729 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7269-3p

Accession MIMAT0028509
Sequence

43 - 

ccccccccaagcaguuuuuucc

 - 64

Get sequence
Deep sequencing1141 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).