Stem-loop sequence mdo-mir-7268

AccessionMI0023770 (change log)
DescriptionMonodelphis domestica miR-7268 stem-loop
Stem-loop
   --caa    ac  u    cug   --    a 
5'      cugg  cg ggcc   ccu  ggca u
        ||||  || ||||   |||  |||| u
3'      gacc  gu ucgg   gga  ccgu a
   ucuuc    -a  c    -ua   cc    g 
Get sequence
Deep sequencing
50360 reads, 680 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 517205669-517205727 [-]
sense
ENSMODT00000013207 ; SLC43A2-201; intron 2
antisense
ENSMODT00000013102 ; SERPINF2-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-7268
mdo-mir-7268chr2: 517205669-517205727 [-]
mdo-mir-3600chr2: 517205535-517205596 [+]
mdo-mir-22chr2: 517205525-517205605 [-]
Database links

Mature sequence mdo-miR-7268-5p

Accession MIMAT0028506
Sequence

1 - 

caacuggaccguggcccugccugg

 - 24

Get sequence
Deep sequencing46085 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7268-3p

Accession MIMAT0028507
Sequence

38 - 

aggauggcucugaccagcuucu

 - 59

Get sequence
Deep sequencing4275 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).