Stem-loop sequence mdo-mir-7267

AccessionMI0023769 (change log)
DescriptionMonodelphis domestica miR-7267 stem-loop
Stem-loop
   --   a     uua   ---     u      c 
5'   ugg uuggg   gau   uggau ggauug u
     ||| |||||   |||   ||||| |||||| u
3'   acc gaccc   cua   accua ccuaau c
   cu   g     cac   ccg     -      a 
Get sequence
Deep sequencing
2310 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 504461004-504461066 [-]
sense
ENSMODT00000024409 ; RAB11FIP4-201; intron 3
Database links

Mature sequence mdo-miR-7267-5p

Accession MIMAT0028504
Sequence

1 - 

uggauuggguuagauuggauugg

 - 23

Get sequence
Deep sequencing2307 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7267-3p

Accession MIMAT0028505
Sequence

38 - 

cauccagccauccaccccaggccauc

 - 63

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).