Stem-loop sequence mdo-mir-30c-1

AccessionMI0023768 (change log)
DescriptionMonodelphis domestica miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u    a  u   aca         --g   a 
5'    guaa ca ccu   cucucagcu   ugg a
      |||| || |||   |||||||||   |||  
3'    cauu gu gga   gagggucga   acu a
   ucu    -  c   --a         aag   g 
Get sequence
Deep sequencing
120417 reads, 1.72e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 322643034-322643094 [-]
sense
ENSMODT00000040399 ; mdo-mir-30c-1-201; exon 1
Database links

Mature sequence mdo-miR-30c-5p

Accession MIMAT0028502
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Deep sequencing240391 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-30c-1-3p

Accession MIMAT0028503
Sequence

42 - 

ugggagaaggcuguuacucu

 - 61

Get sequence
Deep sequencing33 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).