Stem-loop sequence mdo-mir-7266

AccessionMI0023767 (change log)
DescriptionMonodelphis domestica miR-7266 stem-loop
Stem-loop
   --a    aa      -     ccaca 
5'    aucc  ugcucu uucca     c
      ||||  |||||| |||||      
3'    uggg  acgaga agggu     c
   aga    ag      u     uccca 
Get sequence
Deep sequencing
261 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 279202650-279202700 [-]
intergenic
Database links

Mature sequence mdo-miR-7266-5p

Accession MIMAT0028500
Sequence

1 - 

aauccaaugcucuuuccacca

 - 21

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7266-3p

Accession MIMAT0028501
Sequence

30 - 

uugggauagagcagaggguaga

 - 51

Get sequence
Deep sequencing258 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).