Stem-loop sequence mdo-mir-7265

AccessionMI0023766 (change log)
DescriptionMonodelphis domestica miR-7265 stem-loop
Stem-loop
   cag a           u    c   g 
5'    g guagccgccag cgcc gug a
      | ||||||||||| |||| ||| g
3'    c cauuggcgguu gcgg cgc u
   ugg -           c    a   g 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 274924413-274924466 [-]
sense
ENSMODT00000017496 ; mdo-mir-7265-201; 5'UTR (exon 1)
Database links

Mature sequence mdo-miR-7265-5p

Accession MIMAT0028498
Sequence

1 - 

caggaguagccgccagucgcccgug

 - 25

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7265-3p

Accession MIMAT0028499
Sequence

33 - 

caggcgcuuggcgguuaccggu

 - 54

Get sequence
Deep sequencing98 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).