Stem-loop sequence mdo-mir-7264

AccessionMI0023765 (change log)
DescriptionMonodelphis domestica miR-7264 stem-loop
Stem-loop
   --ug           aa       auaa     c 
5'     gcuguuuagga  ugagaag    uuacu u
       |||||||||||  |||||||    |||||  
3'     cgguaagucuu  acucuuc    agugg a
   ugga           -a       ---c     u 
Get sequence
Deep sequencing
863 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 267617182-267617245 [-]
sense
ENSMODT00000020054 ; DDX39B-201; exon 4
Database links

Mature sequence mdo-miR-7264-5p

Accession MIMAT0028496
Sequence

1 - 

uggcuguuuaggaaaugagaaga

 - 23

Get sequence
Deep sequencing604 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7264-3p

Accession MIMAT0028497
Sequence

43 - 

uucucaauucugaauggcaggu

 - 64

Get sequence
Deep sequencing259 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).