Stem-loop sequence mdo-mir-196a

AccessionMI0023764 (change log)
DescriptionMonodelphis domestica miR-196a stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --     a    cc    g   ggcc   a 
5'   uaggu guuu  uguu uug    uag u
     ||||| ||||  |||| |||    |||  
3'   gucca caaa  acaa aac    auc u
   ua     c    cu    g   acaa   u 
Get sequence
Deep sequencing
120250 reads, 1.8e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 201215985-201216044 [-]
sense
ENSMODT00000040411 ; mdo-mir-196a-201; exon 1
Database links

Mature sequence mdo-miR-196a-5p

Accession MIMAT0028494
Sequence

1 - 

uagguaguuuccuguuguuggg

 - 22

Get sequence
Deep sequencing119978 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-196a-3p

Accession MIMAT0028495
Sequence

39 - 

caagaacaucaaaccaccugau

 - 60

Get sequence
Deep sequencing271 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).