Stem-loop sequence mdo-mir-7263

AccessionMI0023763 (change log)
DescriptionMonodelphis domestica miR-7263 stem-loop
Stem-loop
   --         -cuc   c     -c    a 
5'   gaggcauuc    aag cuaug  auaa a
     |||||||||    ||| |||||  ||||  
3'   uuccguaag    uuc gguac  uauu a
   ug         acau   a     uc    a 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 76169639-76169698 [+]
sense
ENSMODT00000008509 ; CACNA1E-201; intron 31
Database links

Mature sequence mdo-miR-7263-5p

Accession MIMAT0028492
Sequence

1 - 

gaggcauuccucaagccuaug

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7263-3p

Accession MIMAT0028493
Sequence

39 - 

uggacuuuacagaaugccuugu

 - 60

Get sequence
Deep sequencing84 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).