Stem-loop sequence mdo-mir-9a-3

AccessionMI0023762 (change log)
DescriptionMonodelphis domestica miR-9a-3 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc               g      u  ug 
5'     uuugguuaucuagcu uaugag gg  u
       ||||||||||||||| |||||| ||  c
3'     aagccaauagaucga auacuu cu  g
   auga               a      -  ga 
Get sequence
Deep sequencing
2375941 reads, 3.39e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 191328853-191328914 [-]
sense
ENSMODT00000040409 ; mdo-mir-9a-3-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-9a-3
mdo-mir-9c-1chr2: 191328857-191328914 [+]
mdo-mir-9a-3chr2: 191328853-191328914 [-]
Database links

Mature sequence mdo-miR-9a-5p

Accession MIMAT0004087
Previous IDsmdo-miR-9
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Deep sequencing6991910 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-9a-3p

Accession MIMAT0004088
Previous IDsmdo-miR-9*
Sequence

40 - 

auaaagcuagauaaccgaaagu

 - 61

Get sequence
Deep sequencing145444 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).