Stem-loop sequence mdo-mir-7262a

AccessionMI0023761 (change log)
DescriptionMonodelphis domestica miR-7262a stem-loop
Stem-loop
   --            a   u    cuu 
5'   aaguuuuauugc guu uaag   u
     |||||||||||| ||| ||||   a
3'   uucagaaugacg caa auuc   g
   uu            g   c    aaa 
Get sequence
Deep sequencing
4984 reads, 60 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 142994547-142994599 [-]
intergenic
Database links

Mature sequence mdo-miR-7262a-5p

Accession MIMAT0028490
Sequence

1 - 

aaguuuuauugcaguuuuaag

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7262a-3p

Accession MIMAT0028491
Sequence

33 - 

uacaacggcaguaagacuuuu

 - 53

Get sequence
Deep sequencing4984 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).