Stem-loop sequence mdo-mir-29b-2

AccessionMI0023760 (change log)
DescriptionMonodelphis domestica miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --          c      g  u    uuuucc 
5'   gcugguuuca auggug cu agau      a
     |||||||||| |||||| || ||||       
3'   ugacuaaagu uaccac ga ucua      u
   ug          u      -  -    ugucuc 
Get sequence
Deep sequencing
68963 reads, 840 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 114184522-114184585 [-]
sense
ENSMODT00000040419 ; mdo-mir-29b-2-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-29b-2
mdo-mir-29b-2chr2: 114184522-114184585 [-]
mdo-mir-29a-2chr2: 114183793-114183848 [-]
Database links

Mature sequence mdo-miR-29b-2-5p

Accession MIMAT0031047
Sequence

1 - 

gcugguuucacaugguggcuuaga

 - 24

Get sequence
Deep sequencing2148 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-29b-3p

Accession MIMAT0004163
Sequence

43 - 

uagcaccauuugaaaucagugu

 - 64

Get sequence
Deep sequencing166470 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).