Stem-loop sequence mdo-mir-29a-2

AccessionMI0023759 (change log)
DescriptionMonodelphis domestica miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --        ucu       ---     u 
5'   ccgauuuc   ugguguu   cagag c
     ||||||||   |||||||   ||||| u
3'   ggcuaaag   accacga   guuuu g
   uu        uuu       ucu     u 
Get sequence
Deep sequencing
35146 reads, 400 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 114183793-114183848 [-]
sense
ENSMODT00000040384 ; mdo-mir-29a-2-201; exon 1
Clustered miRNAs
< 10kb from mdo-mir-29a-2
mdo-mir-29b-2chr2: 114184522-114184585 [-]
mdo-mir-29a-2chr2: 114183793-114183848 [-]
Database links

Mature sequence mdo-miR-29a-2-5p

Accession MIMAT0031023
Sequence

1 - 

ccgauuucucuugguguucag

 - 21

Get sequence
Deep sequencing26 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-29a-3p

Accession MIMAT0004164
Sequence

36 - 

uagcaccauuugaaaucgguu

 - 56

Get sequence
Deep sequencing87309 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).