Stem-loop sequence mdo-mir-7261

AccessionMI0023758 (change log)
DescriptionMonodelphis domestica miR-7261 stem-loop
Stem-loop
   --g   -  a     a        agag  a 
5'    ugg ga gaaag aucuuggc    gc u
      ||| || ||||| ||||||||    || g
3'    acc cu cuuuc uggaaccg    ug g
   uag   u  c     c        -caa  g 
Get sequence
Deep sequencing
299 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 103683709-103683769 [-]
sense
Database links

Mature sequence mdo-miR-7261-5p

Accession MIMAT0028488
Sequence

1 - 

gugggaagaaagaaucuuggca

 - 22

Get sequence
Deep sequencing292 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7261-3p

Accession MIMAT0028489
Sequence

39 - 

ccaagguccuuuccucuccagau

 - 61

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).