Stem-loop sequence mdo-mir-7260

AccessionMI0023757 (change log)
DescriptionMonodelphis domestica miR-7260 stem-loop
Stem-loop
   --a       aa   c      c   aaau 
5'    uggcuaa  caa uguggu cau    g
      |||||||  ||| |||||| |||    u
3'    accgauu  guu acacca gug    a
   uua       cg   a      u   aaua 
Get sequence
Deep sequencing
8043 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 628336542-628336602 [+]
sense
ENSMODT00000003971 ; VPS54-201; intron 9
Database links

Mature sequence mdo-miR-7260-5p

Accession MIMAT0028486
Sequence

1 - 

auggcuaaaacaacuguggucc

 - 22

Get sequence
Deep sequencing7582 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7260-3p

Accession MIMAT0028487
Sequence

40 - 

accacaauuggcuuagccaauu

 - 61

Get sequence
Deep sequencing461 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).