Stem-loop sequence mdo-mir-7259

AccessionMI0023756 (change log)
DescriptionMonodelphis domestica miR-7259 stem-loop
Stem-loop
   --c            c      ccaug u 
5'    cauuccucuaau ccuaug     c a
      |||||||||||| ||||||     |  
3'    gugaggagauug ggauac     g u
   cca            c      auaua u 
Get sequence
Deep sequencing
205 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 604807201-604807258 [+]
sense
ENSMODT00000006923 ; SNX5-201; intron 1
Database links

Mature sequence mdo-miR-7259-5p

Accession MIMAT0028484
Sequence

1 - 

ccauuccucuaaucccuaugc

 - 21

Get sequence
Deep sequencing113 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7259-3p

Accession MIMAT0028485
Sequence

38 - 

auaggcguuagaggagugacc

 - 58

Get sequence
Deep sequencing92 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).