Stem-loop sequence mdo-mir-7257

AccessionMI0023754 (change log)
DescriptionMonodelphis domestica miR-7257 stem-loop
Stem-loop
   --a          a    c       guu 
5'    caugaaccaa acuu uaguuua   u
      |||||||||| |||| |||||||   u
3'    guacuugguu ugaa guuaaau   u
   guc          a    a       aua 
Get sequence
Deep sequencing
184 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 41225367-41225425 [+]
intergenic
Database links

Mature sequence mdo-miR-7257-5p

Accession MIMAT0028480
Sequence

1 - 

acaugaaccaaaacuucuaguu

 - 22

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7257-3p

Accession MIMAT0028481
Sequence

38 - 

uugaaaguauugguucaugcug

 - 59

Get sequence
Deep sequencing145 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).