Stem-loop sequence mdo-mir-181b-2

AccessionMI0023753 (change log)
DescriptionMonodelphis domestica miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --aa         cu           uu ga 
5'     cauucauug  gucgguggguu  u  u
       |||||||||  |||||||||||  |   
3'     guaaguaac  uagucacucaa  a  u
   aaac         --           cu ac 
Get sequence
Deep sequencing
196356 reads, 3.02e+03 reads per million, 5 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 419149425-419149484 [+]
sense
ENSMODT00000028225 ; mdo-mir-181b-2-201; exon 1
antisense
ENSMODT00000025087 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-181b-2
mdo-mir-181a-2chr1: 419148106-419148167 [+]
mdo-mir-181b-2chr1: 419149425-419149484 [+]
Database links

Mature sequence mdo-miR-181b-5p

Accession MIMAT0004155
Sequence

1 - 

aacauucauugcugucggugggu

 - 23

Get sequence
Deep sequencing599624 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181b-2-3p

Accession MIMAT0031046
Sequence

40 - 

ucacugaucaaugaaugcaaa

 - 60

Get sequence
Deep sequencing371 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).