Stem-loop sequence mdo-mir-181a-2

AccessionMI0023752 (change log)
DescriptionMonodelphis domestica miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --a   u      cu       a      aga 
5'    aca ucaacg  gucggug guuuuu   u
      ||| ||||||  ||||||| ||||||   u
3'    ugu aguugc  cagcuac caaaga   u
   ccg   c      --       -      aaa 
Get sequence
Deep sequencing
2290352 reads, 3.88e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 419148106-419148167 [+]
sense
ENSMODT00000040416 ; mdo-mir-181a-2-201; exon 1
antisense
ENSMODT00000025087 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from mdo-mir-181a-2
mdo-mir-181a-2chr1: 419148106-419148167 [+]
mdo-mir-181b-2chr1: 419149425-419149484 [+]
Database links

Mature sequence mdo-miR-181a-5p

Accession MIMAT0004154
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Deep sequencing6759945 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-181a-2-3p

Accession MIMAT0031045
Sequence

42 - 

ccaucgaccguugacugugcc

 - 62

Get sequence
Deep sequencing37500 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).