Stem-loop sequence mdo-mir-7256

AccessionMI0023751 (change log)
DescriptionMonodelphis domestica miR-7256 stem-loop
Stem-loop
   --      c      ca         u 
5'   cguuuc ucuuuu  gcccacggg g
     |||||| ||||||  |||||||||  
3'   gcaaag agagaa  cggguguuu g
   ua      a      ac         g 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 3445803-3445856 [+]
intergenic
Database links

Mature sequence mdo-miR-7256-5p

Accession MIMAT0028478
Sequence

1 - 

cguuuccucuuuucagcccacg

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7256-3p

Accession MIMAT0028479
Sequence

33 - 

ugggccaaagagaagaaacgau

 - 54

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).