Stem-loop sequence mdo-mir-7254

AccessionMI0023749 (change log)
DescriptionMonodelphis domestica miR-7254 stem-loop
Stem-loop
   --    ca  u       uc    -  uaau 
5'   ucac  cc ccuugaa  cugu uc    g
     ||||  || |||||||  |||| ||     
3'   ggug  gg gggacuu  gacg ag    u
   cc    ua  u       ga    u  ugag 
Get sequence
Deep sequencing
4381 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 398141671-398141731 [+]
intergenic
Database links

Mature sequence mdo-miR-7254-5p

Accession MIMAT0028474
Sequence

1 - 

ucaccaccuccuugaauccugu

 - 22

Get sequence
Deep sequencing4321 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-7254-3p

Accession MIMAT0028475
Sequence

40 - 

agaguucaggguggauguggcc

 - 61

Get sequence
Deep sequencing55 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).