Stem-loop sequence mdo-mir-7253

AccessionMI0023748 (change log)
DescriptionMonodelphis domestica miR-7253 stem-loop
Stem-loop
   --        u       gc    ccu   ac 
5'   cggcaaac auggucu  cgcc   ugu  a
     |||||||| |||||||  ||||   |||   
3'   gccguuug uaccggg  gcgg   aca  a
   ca        c       uu    ---   aa 
Get sequence
Deep sequencing
1180 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 391799412-391799472 [+]
sense
ENSMODT00000001472 ; PTPRT-201; intron 7
Database links

Mature sequence mdo-miR-7253-5p

Accession MIMAT0028472
Sequence

1 - 

cggcaaacuauggucugccgcc

 - 22

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7253-3p

Accession MIMAT0028473
Sequence

40 - 

cguugggccaucguuugccgac

 - 61

Get sequence
Deep sequencing1178 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).