Stem-loop sequence mdo-mir-7252

AccessionMI0023747 (change log)
DescriptionMonodelphis domestica miR-7252 stem-loop
Stem-loop
   --uu      a     a       - ag 
5'     ggauaa gaaca ggagaua c  u
       |||||| ||||| ||||||| |   
3'     ccuauu cuugu ccucuau g  c
   uucc      c     c       a ga 
Get sequence
Deep sequencing
35 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 387013521-387013575 [+]
intergenic
Database links

Mature sequence mdo-miR-7252-5p

Accession MIMAT0028470
Sequence

1 - 

uuggauaaagaacaaggagaua

 - 22

Get sequence
Deep sequencing34 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7252-3p

Accession MIMAT0028471
Sequence

34 - 

ucucccuguuccuuauccccuu

 - 55

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).