Stem-loop sequence mdo-mir-7251

AccessionMI0023746 (change log)
DescriptionMonodelphis domestica miR-7251 stem-loop
Stem-loop
   --                     augcuaaa 
5'   acuaagcuggguggauaguca        u
     |||||||||||||||||||||        a
3'   ugauucgauucaucuaucagu        u
   cc                     ccuaaccc 
Get sequence
Deep sequencing
1548 reads, 25 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 366217902-366217964 [+]
sense
ENSMODT00000009409 ; TENM2-201; intron 1
Database links

Mature sequence mdo-miR-7251-5p

Accession MIMAT0028468
Sequence

1 - 

acuaagcuggguggauaguca

 - 21

Get sequence
Deep sequencing1487 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7251-3p

Accession MIMAT0028469
Sequence

43 - 

acuaucuacuuagcuuagucc

 - 63

Get sequence
Deep sequencing61 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).