Stem-loop sequence mdo-mir-7250

AccessionMI0023745 (change log)
DescriptionMonodelphis domestica miR-7250 stem-loop
Stem-loop
   ua  g  c    a   aa      gcaug  g 
5'   cg cc cucc ggg  ccacgu     ag g
     || || |||| |||  ||||||     ||  
3'   gu gg gagg ccc  ggugca     uc a
   ag  a  a    a   -c      -----  a 
Get sequence
Deep sequencing
1881 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 318718771-318718830 [+]
sense
ENSMODT00000016707 ; DEGS2-201; intron 2
Database links

Mature sequence mdo-miR-7250-5p

Accession MIMAT0028466
Sequence

1 - 

uacggccccuccagggaaccacg

 - 23

Get sequence
Deep sequencing1809 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7250-3p

Accession MIMAT0028467
Sequence

41 - 

uggccccaggagaggaugga

 - 60

Get sequence
Deep sequencing72 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).