Stem-loop sequence mdo-mir-7249

AccessionMI0023744 (change log)
DescriptionMonodelphis domestica miR-7249 stem-loop
Stem-loop
   --guu        c c        uugc 
5'      gguacugu u ucucauuu    u
        |||||||| | ||||||||     
3'      cuaugaca a aggguaag    u
   cucuu        a a        ucuc 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 699814288-699814343 [+]
sense
ENSMODT00000003291 ; WWP2-201; intron 5
Database links

Mature sequence mdo-miR-7249-5p

Accession MIMAT0028464
Sequence

1 - 

guugguacugucucucucauu

 - 21

Get sequence
Deep sequencing65 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7249-3p

Accession MIMAT0028465
Sequence

36 - 

ugggaaaaacaguaucuucuc

 - 56

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).