Stem-loop sequence mdo-mir-7248

AccessionMI0023743 (change log)
DescriptionMonodelphis domestica miR-7248 stem-loop
Stem-loop
   ca     c    a    g     -   c 
5'   uagag gugg cugg ugugc ugg a
     ||||| |||| |||| ||||| ||| c
3'   gucuc cacc ggcc acacg acc a
   ac     a    a    a     g   c 
Get sequence
Deep sequencing
25423 reads, 220 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 155944997-155945054 [+]
sense
ENSMODT00000011928 ; CORO2B-201; intron 1
Database links

Mature sequence mdo-miR-7248-5p

Accession MIMAT0028462
Sequence

1 - 

cauagagcguggacugggugugc

 - 23

Get sequence
Deep sequencing22036 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7248-3p

Accession MIMAT0028463
Sequence

38 - 

acaaccggaccacacucugca

 - 58

Get sequence
Deep sequencing3387 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).