Stem-loop sequence mdo-mir-7247

AccessionMI0023742 (change log)
DescriptionMonodelphis domestica miR-7247 stem-loop
Stem-loop
   --      a       g g     uc   
5'   gggaga cgugugu g ggaau  cg 
     |||||| ||||||| | |||||  | a
3'   cucucu gcguaca c cuuug  ga 
   ua      g       g g     gu   
Get sequence
Deep sequencing
787 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 11130355-11130409 [+]
intergenic
Database links

Mature sequence mdo-miR-7247-5p

Accession MIMAT0028460
Sequence

1 - 

gggagaacgugugugggggaa

 - 21

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7247-3p

Accession MIMAT0028461
Sequence

35 - 

ucgcgacaugcggucucucau

 - 55

Get sequence
Deep sequencing785 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).