Stem-loop sequence mdo-mir-7246

AccessionMI0023741 (change log)
DescriptionMonodelphis domestica miR-7246 stem-loop
Stem-loop
   --            -     --    --a gug 
5'   uauccaaccuua uuucc  cacu   c   u
     |||||||||||| |||||  ||||   |    
3'   auagguuggaau aaagg  guga   g   a
   gg            c     ua    gaa aua 
Get sequence
Deep sequencing
30837 reads, 360 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 704776839-704776899 [-]
sense
Database links

Mature sequence mdo-miR-7246-5p

Accession MIMAT0028458
Sequence

1 - 

uauccaaccuuauuucccacu

 - 21

Get sequence
Deep sequencing87 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7246-3p

Accession MIMAT0028459
Sequence

40 - 

auggaaacuaagguuggauagg

 - 61

Get sequence
Deep sequencing30750 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).