Stem-loop sequence mdo-mir-7245

AccessionMI0023740 (change log)
DescriptionMonodelphis domestica miR-7245 stem-loop
Stem-loop
   --         uu     -     guaug 
5'   agguccaau  uacau gcccu     a
     |||||||||  ||||| |||||     a
3'   uccagguug  gugua cggga     a
   ug         gu     u     aaaau 
Get sequence
Deep sequencing
248 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 577087574-577087631 [-]
intergenic
Database links

Mature sequence mdo-miR-7245-5p

Accession MIMAT0028456
Sequence

1 - 

agguccaauuuuacaugcccu

 - 21

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7245-3p

Accession MIMAT0028457
Sequence

37 - 

ggcuaugugugguuggaccugu

 - 58

Get sequence
Deep sequencing245 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).