Stem-loop sequence mdo-mir-7244

AccessionMI0023739 (change log)
DescriptionMonodelphis domestica miR-7244 stem-loop
Stem-loop
   --        a            u   a 
5'   uaugggaa agcaggugaaaa gug u
     |||||||| |||||||||||| ||| a
3'   auauccuu uuguccacuuuu uau u
   uu        c            u   g 
Get sequence
Deep sequencing
933 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 553093580-553093636 [-]
intergenic
Database links

Mature sequence mdo-miR-7244-5p

Accession MIMAT0028454
Sequence

1 - 

uaugggaaaagcaggugaaa

 - 20

Get sequence
Deep sequencing751 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7244-3p

Accession MIMAT0028455
Sequence

38 - 

ucaccuguucuuccuauauu

 - 57

Get sequence
Deep sequencing182 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).