Stem-loop sequence mmu-mir-7242

AccessionMI0023737 (change log)
Symbol MGI:Mir7242
DescriptionMus musculus miR-7242 stem-loop
Stem-loop
   -----auu     ugg   g    --u   cucaa    u     u 
5'         gggcu   gag ugcu   gug     agcc ccuuc c
           |||||   ||| ||||   |||     |||| ||||| c
3'         cucgg   cuc acgg   cac     ucgg ggaag a
   ggucucau     ---   g    uuc   -----    -     u 
Get sequence
Deep sequencing
1069 reads, 17.6 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 67729499-67729577 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7242
mmu-mir-7242chr9: 67729499-67729577 [-]
mmu-mir-7241chr9: 67727717-67727780 [-]
Database links

Mature sequence mmu-miR-7242-5p

Accession MIMAT0028452
Sequence

1 - 

auugggcuugggaggugcuugu

 - 22

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7242-3p

Accession MIMAT0028453
Sequence

58 - 

uggcagcucggcucuacucugg

 - 79

Get sequence
Deep sequencing481 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).