Stem-loop sequence mmu-mir-7241

AccessionMI0023736 (change log)
Symbol MGI:Mir7241
DescriptionMus musculus miR-7241 stem-loop
Stem-loop
   --a   g       uaa   cc  - u    au 
5'    cuu caugagu   uac  ac c ggcu  c
      ||| |||||||   |||  || | ||||   
3'    gag guacuca   aug  ug g ccga  u
   cga   g       uag   -a  c u    cc 
Get sequence
Deep sequencing
4850 reads, 135 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 67727717-67727780 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7241
mmu-mir-7242chr9: 67729499-67729577 [-]
mmu-mir-7241chr9: 67727717-67727780 [-]
Database links

Mature sequence mmu-miR-7241-5p

Accession MIMAT0028450
Sequence

1 - 

acuugcaugaguuaauacccacc

 - 23

Get sequence
Deep sequencing65 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7241-3p

Accession MIMAT0028451
Sequence

43 - 

uaguagauacucaugggagagc

 - 64

Get sequence
Deep sequencing4758 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).