Stem-loop sequence mmu-mir-7240

AccessionMI0023735 (change log)
Symbol MGI:Mir7240
DescriptionMus musculus miR-7240 stem-loop
Stem-loop
   --             c  u   a uccuc 
5'   uuggagaggaccg cg cgg c     c
     ||||||||||||| || ||| |      
3'   aaccucuccuggu gc gcc g     u
   ac             u  c   c ucccg 
Get sequence
Deep sequencing
202 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 70798135-70798192 [+]
intergenic
Database links

Mature sequence mmu-miR-7240-5p

Accession MIMAT0028448
Sequence

1 - 

uuggagaggaccgccgucgga

 - 21

Get sequence
Deep sequencing196 reads, 30 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7240-3p

Accession MIMAT0028449
Sequence

38 - 

cgccguugguccucuccaaca

 - 58

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).