Stem-loop sequence mmu-mir-7239

AccessionMI0023734 (change log)
Symbol MGI:Mir7239
DescriptionMus musculus miR-7239 stem-loop
Stem-loop
   --   au       a    cuuuucu  u 
5'   gcc  ccugaca agcc       gc c
     |||  ||||||| ||||       ||  
3'   ugg  ggacugu ucgg       cg a
   ga   ac       c    -uaacac  a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 46170087-46170143 [+]
intergenic
Database links

Mature sequence mmu-miR-7239-5p

Accession MIMAT0028446
Sequence

1 - 

gccauccugacaaagcccuu

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7239-3p

Accession MIMAT0028447
Sequence

38 - 

uggcucugucaggcagguag

 - 57

Get sequence
Deep sequencing27 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).