Stem-loop sequence mmu-mir-7237

AccessionMI0023732 (change log)
Symbol MGI:Mir7237
DescriptionMus musculus miR-7237 stem-loop
Stem-loop
   --a     -    gu       c    cc   gg 
5'    uggua gcuu  gacagga uggc  uug  a
      ||||| ||||  ||||||| ||||  |||   
3'    gccau cgag  uuguccu accg  aac  g
   cga     u    --       -    -a   ga 
Get sequence
Deep sequencing
130 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 121978024-121978086 [+]
sense
OTTMUST00000064647 ; AC114005.5-001; intron 1
OTTMUST00000094815 ; Banp-016; intron 2
OTTMUST00000094803 ; Banp-005; intron 3
OTTMUST00000094792 ; Banp-002; intron 3
OTTMUST00000094791 ; Banp-001; intron 3
OTTMUST00000094808 ; Banp-010; intron 3
OTTMUST00000094793 ; Banp-003; intron 3
OTTMUST00000094813 ; Banp-015; intron 3
OTTMUST00000094809 ; Banp-014; intron 3
OTTMUST00000094810 ; Banp-013; intron 5
ENSMUST00000127664 ; Gm20388-001; intron 1
ENSMUST00000173254 ; Banp-016; intron 2
ENSMUST00000172628 ; Banp-005; intron 3
ENSMUST00000093078 ; Banp-002; intron 3
ENSMUST00000170857 ; Banp-001; intron 3
ENSMUST00000172681 ; Banp-010; intron 3
ENSMUST00000026354 ; Banp-003; intron 3
ENSMUST00000174753 ; Banp-015; intron 3
ENSMUST00000174445 ; Banp-014; intron 3
ENSMUST00000172511 ; Banp-013; intron 5
Database links

Mature sequence mmu-miR-7237-5p

Accession MIMAT0028442
Sequence

1 - 

augguagcuugugacaggacuggc

 - 24

Get sequence
Deep sequencing28 reads, 19 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7237-3p

Accession MIMAT0028443
Sequence

42 - 

cauccuguugagcuuaccgagc

 - 63

Get sequence
Deep sequencing99 reads, 30 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).