Stem-loop sequence mmu-mir-7236

AccessionMI0023731 (change log)
Symbol MGI:Mir7236
DescriptionMus musculus miR-7236 stem-loop
Stem-loop
   --c     a            au   auuua 
5'    cuaaa cuguguggucca  gcc     a
      ||||| ||||||||||||  |||      
3'    gauuu gacacgccaggu  ugg     c
   cca     a            --   accau 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 121387145-121387204 [-]
sense
OTTMUST00000010557 ; Rab40b-001; intron 1
OTTMUST00000010560 ; Rab40b-004; intron 1
OTTMUST00000010558 ; Rab40b-002; intron 1
OTTMUST00000010559 ; Rab40b-003; intron 1
ENSMUST00000106107 ; Rab40b-001; intron 1
ENSMUST00000149948 ; Rab40b-004; intron 1
ENSMUST00000124639 ; Rab40b-002; intron 1
ENSMUST00000135290 ; Rab40b-003; intron 1
Database links

Mature sequence mmu-miR-7236-5p

Accession MIMAT0028440
Sequence

1 - 

ccuaaaacugugugguccaaugcc

 - 24

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7236-3p

Accession MIMAT0028441
Sequence

39 - 

uuggaccgcacagauuuagacc

 - 60

Get sequence
Deep sequencing119 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).