Stem-loop sequence mmu-mir-7235

AccessionMI0023730 (change log)
Symbol MGI:Mir7235
DescriptionMus musculus miR-7235 stem-loop
Stem-loop
   --         -----    u    aga  u 
5'   ggagggagg     gguc gggc   ag g
     |||||||||     |||| ||||   || a
3'   ccucucuuc     ucag cucg   uc a
   cu         guucu    u    --g  g 
Get sequence
Deep sequencing
107 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 97146364-97146419 [-]
sense
OTTMUST00000004588 ; Tbkbp1-001; intron 5
OTTMUST00000076463 ; Tbkbp1-005; intron 6
OTTMUST00000004590 ; Tbkbp1-003; intron 6
OTTMUST00000004589 ; Tbkbp1-002; intron 7
ENSMUST00000107615 ; Tbkbp1-001; intron 5
ENSMUST00000066078 ; Tbkbp1-201; intron 5
ENSMUST00000118375 ; Tbkbp1-005; intron 6
ENSMUST00000107614 ; Tbkbp1-003; intron 6
ENSMUST00000107613 ; Tbkbp1-002; intron 7
Database links

Mature sequence mmu-miR-7235-5p

Accession MIMAT0028438
Sequence

1 - 

ggagggaggggucugggc

 - 18

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7235-3p

Accession MIMAT0028439
Sequence

34 - 

ucugacuucuugcuucucuccuc

 - 56

Get sequence
Deep sequencing99 reads, 26 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).