Stem-loop sequence mmu-mir-7234

AccessionMI0023729 (change log)
Symbol MGI:Mir7234
DescriptionMus musculus miR-7234 stem-loop
Stem-loop
   uugu     -  ----            a 
5'     uuucu cc    aaagacguuucu g
       ||||| ||    ||||||||||||  
3'     gaaga gg    uuucugcaaaga g
   ---g     u  gauc            u 
Get sequence
Deep sequencing
3826 reads, 189 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 73819590-73819641 [+]
intergenic
Database links

Mature sequence mmu-miR-7234-5p

Accession MIMAT0028436
Sequence

1 - 

uuguuuucuccaaagacguuucu

 - 23

Get sequence
Deep sequencing1059 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7234-3p

Accession MIMAT0028437
Sequence

30 - 

aaacgucuuucuaggguagaagg

 - 52

Get sequence
Deep sequencing2746 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).