Stem-loop sequence mmu-mir-7233

AccessionMI0023728 (change log)
Symbol MGI:Mir7233
DescriptionMus musculus miR-7233 stem-loop
Stem-loop
   aguuag    aga    u    ag   gucuu 
5'       ggac   uaga ggca  caa     g
         ||||   |||| ||||  |||     a
3'       ucug   auuu ccgu  guu     u
   ----ca    --g    -    cu   auauc 
Get sequence
Deep sequencing
736 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 127788084-127788143 [-]
intergenic
Database links

Mature sequence mmu-miR-7233-5p

Accession MIMAT0028434
Sequence

1 - 

aguuagggacagauagaug

 - 19

Get sequence
Deep sequencing410 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7233-3p

Accession MIMAT0028435
Sequence

39 - 

uauugucugccuuuaggucuac

 - 60

Get sequence
Deep sequencing293 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).