Stem-loop sequence mmu-mir-7232

AccessionMI0023727 (change log)
Symbol MGI:Mir7232
DescriptionMus musculus miR-7232 stem-loop
Stem-loop
   --ua  u  a   uu    uu          -   a ca 
5'     ca gg uga  guuu  ccaaggcuuu cgu g  a
       || || |||  ||||  |||||||||| ||| |   
3'     gu uc gcu  uaag  gguucugaaa gca c  g
   cggg  u  a   --    uu          a   - ac 
Get sequence
Deep sequencing
1370 reads, 46.7 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 81895590-81895663 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7232
mmu-mir-468chr6: 81896599-81896676 [-]
mmu-mir-7232chr6: 81895590-81895663 [-]
Database links

Mature sequence mmu-miR-7232-5p

Accession MIMAT0028432
Sequence

1 - 

uacauggaugauuguuuuuccaag

 - 24

Get sequence
Deep sequencing661 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7232-3p

Accession MIMAT0028433
Sequence

53 - 

ugguugaauucgacuuuggggc

 - 74

Get sequence
Deep sequencing641 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).