Stem-loop sequence mmu-mir-7231

AccessionMI0023726 (change log)
Symbol MGI:Mir7231
DescriptionMus musculus miR-7231 stem-loop
Stem-loop
   --        -  cu      uacccaaugc 
5'   uuggggaa ca  ggggca          u
     |||||||| ||  ||||||           
3'   gaccccuu gu  cuucgu          c
   aa        u  uu      ucaauccaga 
Get sequence
Deep sequencing
300 reads, 3.57 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 122831377-122831437 [+]
sense
OTTMUST00000056641 ; Foxj2-001; 3'UTR (exon 3)
ENSMUST00000003238 ; Foxj2-001; 3'UTR (exon 3)
ENSMUST00000177927 ; Foxj2-201; 3'UTR (exon 4)
Database links

Mature sequence mmu-miR-7231-5p

Accession MIMAT0028430
Sequence

1 - 

uuggggaacacuggggcauacc

 - 22

Get sequence
Deep sequencing299 reads, 28 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7231-3p

Accession MIMAT0028431
Sequence

39 - 

cuugcuucuuuguuuccccagaa

 - 61

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).