Stem-loop sequence mmu-mir-7230

AccessionMI0023725 (change log)
Symbol MGI:Mir7230
DescriptionMus musculus miR-7230 stem-loop
Stem-loop
   aga      --uu    -ugagu     c 
5'    cugcug    ucuc      ggcuu u
      ||||||    ||||      |||||  
3'    gaugac    agag      ucggg g
   -ug      uguc    uugagu     g 
Get sequence
Deep sequencing
1382 reads, 21.1 reads per million, 19 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 113337590-113337645 [-]
intergenic
Database links

Mature sequence mmu-miR-7230-5p

Accession MIMAT0028428
Sequence

1 - 

agacugcuguuucucugaguggc

 - 23

Get sequence
Deep sequencing762 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7230-3p

Accession MIMAT0028429
Sequence

34 - 

uugaguugagacugucaguaggu

 - 56

Get sequence
Deep sequencing548 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).