Stem-loop sequence mmu-mir-7229

AccessionMI0023724 (change log)
Symbol MGI:Mir7229
DescriptionMus musculus miR-7229 stem-loop
Stem-loop
   ua     -ca  c    -----a     u 
5'   guaga   uc cugg      uagcc c
     |||||   || ||||      |||||  
3'   cgucu   ag gacc      aucgg a
   -a     uuc  u    agacac     a 
Get sequence
Deep sequencing
1032 reads, 64.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 113324493-113324545 [-]
intergenic
Database links

Mature sequence mmu-miR-7229-5p

Accession MIMAT0028426
Sequence

1 - 

uaguagacaucccuggauagc

 - 21

Get sequence
Deep sequencing977 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7229-3p

Accession MIMAT0028427
Sequence

30 - 

uacacagaccagugacuuucugca

 - 53

Get sequence
Deep sequencing55 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).