Stem-loop sequence mmu-mir-7227

AccessionMI0023722 (change log)
Symbol MGI:Mir7227
DescriptionMus musculus miR-7227 stem-loop
Stem-loop
   ---u         -      uu    aaua 
5'     cugaugacu uuuuca  gaaa    c
       ||||||||| ||||||  ||||    u
3'     ggcuacugg aaaagu  cuuu    u
   agac         g      cu    aucg 
Get sequence
Deep sequencing
301 reads, 3.64 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 133717050-133717108 [-]
sense
OTTMUST00000025856 ; Arid1a-001; intron 4
OTTMUST00000092228 ; Arid1a-002; intron 4
OTTMUST00000092230 ; Arid1a-003; intron 4
ENSMUST00000145664 ; Arid1a-001; intron 4
ENSMUST00000008024 ; Arid1a-002; intron 4
ENSMUST00000138473 ; Arid1a-003; intron 4
ENSMUST00000105897 ; Arid1a-201; intron 4
Database links

Mature sequence mmu-miR-7227-5p

Accession MIMAT0028422
Sequence

1 - 

ucugaugacuuuuucauuga

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7227-3p

Accession MIMAT0028423
Sequence

38 - 

ucugaaaagggucaucggcaga

 - 59

Get sequence
Deep sequencing300 reads, 54 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).