Stem-loop sequence mmu-mir-7226

AccessionMI0023721 (change log)
Symbol MGI:Mir7226
DescriptionMus musculus miR-7226 stem-loop
Stem-loop
   --  -       gu  au     gaa     c 
5'   gc cagggaa  ug  ugugu   gggag a
     || |||||||  ||  |||||   ||||| g
3'   cg gucucuu  ac  acaca   uccuc g
   ga  a       --  cg     --g     a 
Get sequence
Deep sequencing
427 reads, 14.3 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 118210505-118210564 [-]
sense
OTTMUST00000019814 ; Ptprf-006; intron 1
OTTMUST00000019812 ; Ptprf-004; intron 9
OTTMUST00000019810 ; Ptprf-002; intron 23
OTTMUST00000019811 ; Ptprf-003; intron 23
OTTMUST00000019809 ; Ptprf-001; intron 31
ENSMUST00000127616 ; Ptprf-006; intron 1
ENSMUST00000123484 ; Ptprf-004; intron 9
ENSMUST00000150096 ; Ptprf-002; intron 23
ENSMUST00000124758 ; Ptprf-003; intron 23
ENSMUST00000049074 ; Ptprf-001; intron 31
Database links

Mature sequence mmu-miR-7226-5p

Accession MIMAT0028420
Sequence

1 - 

gccagggaaguugauugugugaaggg

 - 26

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7226-3p

Accession MIMAT0028421
Sequence

38 - 

ugacacagccauucucugagcag

 - 60

Get sequence
Deep sequencing409 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).